Аутор Тема: Објашњење главних појмова везаних за генетичку генеалогију  (Прочитано 21042 пута)

Ван мреже Kor

  • Члан Друштва
  • Истраживач
  • *****
  • Поруке: 814
  • реверзни инжињеринг историје
Три врло важна термина која се користе у генетици и везана су за утврђивање порекла су  SNPSTR и маркер

Једнонуклеотидни полиморфизам (SNP, изговара се Снип) је ДНК варијација која настаје када се један нуклеотид - А, Т, Ц или Г -  разликује између два припадника врсте. На пример, два фрагмента од различитих појединаца, ААГЦЦТА и ААГЦТТА, се разликују у једном нуклеотиду. У овом случају кажемо да постоје два алела: Ц и Т. Скоро сви уобичајени СНП имају само два алела.



====================================================

Иако није јасно зашто, али природа више пута дуплира исте информације записане у локусима (локацијама) Y хромозома. Понављање варира и до 40 пута. Сваких неколико генерација, на сваком локусу деси се мутација , Број понављања може да се смањује или расте.

У следећем примеру локуса девет пута се поновио запис ТСТА. У научној литератури, такви понављајући записи се зову кратки низови понављања, или STR (Short Tandem Repeat).



Анализа Y хромозома открива тачан број понављања у локусу. Локус са познатим бројем понављања се зове маркер. ДНК потпис особе је низ бројева који представљају вредности  маркера. У доњој табели се приказује име локуса на дну - број понављања у локусима. На пример, DYS393 са вредношћу 13, је маркер.



Mаркери      DYS393 DYS390 DYS19 DYS391 DYS385a DYS385b DYS426 DYS388 DYS439 DYS389i DYS392 DYS389ii
ДНК потпис       13         25      16          10          11            14         12      12          10          13        11          30

У ДНК потпису је одеређен специфичан редослед маркера, тако да запис
13 25 16 10 11 14 12 12 10 13 11 30 има јасно значење, сви знају да је прва цифра 13 је маркер локуса DYS 393, а друга - локусa DYS 390.

Када урадите ДНК тест, добићете податке управо у овом формату, односно, пребојаће вам број понављања секвенце нуклеотида. Касније се ти подаци убацују у компјутерске програме који олакшавају одређивање групације људи са којом сте највише сродни.
« Последња измена: јануар 10, 2013, 02:23:57 поподне Kor »

Ван мреже Kor

  • Члан Друштва
  • Истраживач
  • *****
  • Поруке: 814
  • реверзни инжињеринг историје
Одг: Објашњење главних појмова везаних за генетичку генеалогију
« Одговор #1 послато: јануар 08, 2013, 07:11:55 поподне »
Пошто знамо да се многи плаше науке и великих и компликованих формула, само ћемо укратко навести  информације о стварима на којима се заснива генетика.

Нуклеинске киселине
су крупни и сложени органски молекули значајни за ћелију и одговорни за најзначајније процесе, као што су наслеђивање и синтеза протеина.

Постоје два типа нуклеинских киселина:
    дезоксирибонуклеинска киселина (ДНК) и
    рибонуклеинска киселина (РНК).

ДНК је носилац наследних информација у ћелији, док РНК учествују у преношењу тих информација и њиховом превођењу у протеине.


Нуклеотид
је основна јединица грађе и функције нуклеинских киселина. Нуклеотид је мономер нуклеинских киселина. Нуклеотиди једног полинуклеотидног ланца су везани јаким фосфодиестарским везама.

У изградњи нуклеотида учествују:

    један пентозни шећер (дезоксирибоза или рибоза од којих зависи да ли ће бити ДНК или РНК)
    једна пуринска база (аденин или гуанин), или пиримидинска база (цитозин, тимин).
    једна фосфатна група

Дакле, због ових пиримидинских и пуринских база, мутације схематски означавамо словима А,Г, Ц и Т.



ЗА генетичку генеалогију ово није толико важно већ је довољно оперисати са појмовима SNP и посебно STR.
« Последња измена: новембар 07, 2013, 06:20:28 поподне Kor »

Ван мреже Kor

  • Члан Друштва
  • Истраживач
  • *****
  • Поруке: 814
  • реверзни инжињеринг историје
Одг: Објашњење главних појмова везаних за генетичку генеалогију
« Одговор #2 послато: јануар 08, 2013, 07:20:26 поподне »
Када дође до промене ових нуклеотида, кажемо да се десила мутација. Српска Википедија за мутацију каже следеће:

Цитат

Мутације (лат. mutatio = промена) представљају промене редоследа нуклеотида у ДНК које се трајно задржавају и преносе на потомачке ћелије. Дешавају се у свим ћелијама и организмима као:

    спонтане мутације које су резултат нормалног функционисања организама и његовом прилагођавању условима спољашње средине;
    индуковане мутације које настају деловањем различитих физичких, хемијских или биолошких фактора, тзв. мутагена.



Мутације се преносе наследним материјалом из генерације у генерацију, а могу бити изазване низом фактора (тзв. мутагенима). У мутагене између осталих убрајамо радиоактивно зрачење, вирусе, хемијска једињења
« Последња измена: јануар 10, 2013, 12:24:27 пре подне Kor »

Ван мреже Kor

  • Члан Друштва
  • Истраживач
  • *****
  • Поруке: 814
  • реверзни инжињеринг историје
Одг: Објашњење главних појмова везаних за генетичку генеалогију
« Одговор #3 послато: јануар 09, 2013, 01:46:50 поподне »
Сада да визуелно разумемо где се налазе информације о генима.

Следећа илустрација у општим цртама приказује ћелију (са десне стране је приказ хромозома).


У митохондријама се налази тзв. мДНК (митохондријална ДНК), док се у једру налазе хромозоми који у себи носе ДНК информацију. Хромозоми имају карактеристични облик који потсећа на слово Х.

Тро-димензионални изглед једра је овакав:



Сада ћемо да "зумирамо" један хромозом:



Слика 6 показује како изгледа хромозом. Идући ка слици 1 видимо како се он "размотава" све до ланца (хеликса) ДНК на слици 1.

« Последња измена: јануар 13, 2013, 03:17:21 поподне Kor »

Ван мреже Kor

  • Члан Друштва
  • Истраживач
  • *****
  • Поруке: 814
  • реверзни инжињеринг историје
Одг: Објашњење главних појмова везаних за генетичку генеалогију
« Одговор #4 послато: јануар 09, 2013, 02:02:52 поподне »
Међу хромозомима постоји један који је налази само код мушкараца (логично да је у питању полни хромозом). Назива се Y  ради свог физичког облика  који се разликује од Х хромозома.

Мушкарци имају један Х и један Y хромозом, док жене имају два Х хромозома.


на слици је Х хромозом приказан ружичастом бојом, док је Y хромозом плаве боје.


Х хромозоми имају око 153 милиона базних парова, док Y хромозом има 3 пута мање, 50 милиона.

« Последња измена: јануар 09, 2013, 04:32:48 поподне Kor »

Ван мреже Kor

  • Члан Друштва
  • Истраживач
  • *****
  • Поруке: 814
  • реверзни инжињеринг историје
Одг: Објашњење главних појмова везаних за генетичку генеалогију
« Одговор #5 послато: јануар 09, 2013, 02:31:49 поподне »
Када се одлучите на генетички тест на порекло по мушкој линији, тестира се ваш хромозом Y. У првом посту смо објаснили шта је то STR. Као резултате тог теста, добићете  нешто слично овоме:

  DYS 393  DYS 390  DYS 19  DYS 391  DYS 385a  DYS 385b  DYS 426  DYS 388  DYS 439 DYS 389i DYS 392 DYS 389ii
        13           25         16         10           11             14           12            12           10          13            11          30

Шта ово све значи?
У претходном посту смо рекли да на Y хромозому имамо 50 милиона базних парова. Да би се лакше снашли у тако великој количини података, научници су поделили Y хромозом на сегменте који се најчешће називају DYS ( енгл. DNA Y Segment, сегмент од Y хромозома ДНК). На доста места ћете за одређено место у геному чути да се назива локус.



На слици видимо да се пребројавају вредности низа нуклеотида од 2. милиона па све до 30. милиона.

 р је кратка рука хромозома, док се дуга рука означава са q.


Ван мреже Kor

  • Члан Друштва
  • Истраживач
  • *****
  • Поруке: 814
  • реверзни инжињеринг историје
Одг: Објашњење главних појмова везаних за генетичку генеалогију
« Одговор #6 послато: јануар 09, 2013, 02:41:47 поподне »
Видимо да се локација DYS 393 налази негде на око 3,1 милиона базних локација од почетка. Када уз помоћ софтистициране опреме погледамо садржај те локације, видећемо тамо следећи низ нуклеотида:

GTGGTCTTCTACTTGTGTCAATACAТATАGAT/AGAT/AGAT/AGAT/ AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/AGAT/ ATGTATGTCTTTTCTATGAGACATACCTCATTTTTTGGACTTGAGTTC

Дакле, на локацији DYS 393 у нашем случају имамо 13 понављања кратких секвенци (за које смо рекли да се називају STR).
« Последња измена: јануар 09, 2013, 03:40:12 поподне Kor »

Ван мреже Kor

  • Члан Друштва
  • Истраживач
  • *****
  • Поруке: 814
  • реверзни инжињеринг историје
Одг: Објашњење главних појмова везаних за генетичку генеалогију
« Одговор #7 послато: јануар 09, 2013, 03:57:11 поподне »
и даље пратимо резултате нашег тестирања, број STR-ова на DYS 390 = 25

Ако будемо посматрали нуклеотиде, то ће изгледати овако:

TATATTTTACACATTTTTGGGCCCTGCATTTTGGTACCCCATAATATATTCTATCTA/TCTG
 /TCTG/TCTG/TCTG/TCTG/TCTG/TCTG/TCTG
/TCTA/TCTA/TCTA/TCTA/TCTA/T
CTA/TCTA/TCTA/TCTA/TCTA/TCTA/TCTA
/TCTG/TCTA/TCTA/TCTA/TCTA/TCATCTATCTATCTTTCCTTGTTTCTGAGTATACACATTGCAATGTTTTCATTTTACTGTCAC

25 понављања али овај пут се рачунају два различита STR ланца: TCTG и TCTA
=======
следећи је DYS 19:
DYS19 је доста популарније име за DYS394 али је то у суштини једно те исто (означавају исту локацију).

у нашем случају имамо 16 STR понављања:

ACTACTGAGTTTCTGTTATAGTGTTTTTTAATATATATATAGTATTATATATA
TAGTGTTATATATATATAGTGTTT/TAGA/TAGA/TAGA/TAGG/TAGA/TAG
A/TAGA/TAGA/TAGA/TAGA/TAGA/TAGA/TAGA/TAGA/TAGA//TAGA/TAGA/
TATAGT
GACACTCTCCTTAACCCAGATGGACTCCTTGTCCTCACTACATGGCCATGGCC
CGAAGTATTACTCCTGGTGCCCCAGCCACTATTTCCAGGTGCAGAGATTGAC

=======
Следећи је DYS 391= 10

TTCATCATACACCCATATCTGTCTGTCTG/TCTA/TCTA/
TCTA/TCTA/TCTA/TCTA/TCTA/TCTA/TCTA/TCTA/
TCTA/
TCTGCCTATCTGCCTGCCTACCTATCCCTCTATC


Надам се да је после овога јасно шта се мери путем генетичких тестова и шта те вредности заправо значе.

Генетички код саставњен од четири нуклеотида A,C, T и G једнак је за сва жива бића. Од бактерије преко наранче, купуса, траве, риба па све до човека.  Колико моћан програм је у питању говори чињеница да од информација записаних у једној јединој ћелији настају читави организми са стотинама милијарди ћелија!
« Последња измена: април 01, 2017, 11:23:50 пре подне Kor »

Ван мреже Kor

  • Члан Друштва
  • Истраживач
  • *****
  • Поруке: 814
  • реверзни инжињеринг историје
Одг: Објашњење главних појмова везаних за генетичку генеалогију
« Одговор #8 послато: јануар 09, 2013, 07:36:56 поподне »
Већ сада знамо да се информација Y хромозома на потомство преноси искључиво преко мушкараца.



Као што видимо, преноси се са пра-прадеда на прадеда, са прадеде на деда, са деда на оца, са оца на сина. 

Информације са Y хромозома о мушким потомцима са мајчине стране се НЕ ПРЕНОСЕ! Међутим, све остале генетичке информације се могу пренети пошто у процесу оплођавања учествује 50% гена од оца и 50% гена од мајке. Тако можемо наследити облик носа, боју очију или косе коју има отац наше мајке.

Због ове карактеристике Y хромозома можемо пратити порекло мушкарца до дубоко у прошлост. 

Ван мреже Kor

  • Члан Друштва
  • Истраживач
  • *****
  • Поруке: 814
  • реверзни инжињеринг историје
Одг: Објашњење главних појмова везаних за генетичку генеалогију
« Одговор #9 послато: јануар 09, 2013, 07:48:49 поподне »
Како утврђујемо рођачке везе између два мушкарца?

Погледајмо следећу табелу:



Овде имамо податке о 3 хаплотипа за три мушкарца. Означени су као брат1, брат2 и не-брат.

У случају брата1 и брата2, њихови резултати тестирања (хаплотипови) се разликују у једној мутацији на 12 маркера. Они спадају у исту хаплогрупу али је њихов заједнички предак живео пре од прилике 40 генерација, што је у просеку 1000-1200 година.

Да су брат1 и брат2 радили тестирање на рецимо 17 маркера, могли би одредити њиховог заједничког претка у диапазону од 250 година. Што се више повећава број тестираних маркера, већа је прецизност  времена живота заједнјичког претка два рођака. Тако у случају 111 маркера који се разликују у само једној вредности своди заједничког претка два човека на свега три генерације.

не-брат из наше табеле има преко 20 мутација више од брата1 и брата 2 на 12 маркера, што значи да је њихов заједнички предак живео пре више од 20000 година. Због тога припада хаплогрупи која се разликује од оне коју имају браћа 1 и 2 и у њој ће бити људи чији хаплотип је много сличнији његовом.


Запамтимо следеће: хаплотип је скуп STR вредности добијен тестирањем појединца, док је хаплогрупа категорија блиских сродника у коју смештамо тај хаплотип.
« Последња измена: новембар 07, 2013, 06:30:36 поподне Kor »

Ван мреже Kor

  • Члан Друштва
  • Истраживач
  • *****
  • Поруке: 814
  • реверзни инжињеринг историје
Одг: Објашњење главних појмова везаних за генетичку генеалогију
« Одговор #10 послато: јануар 10, 2013, 07:34:01 поподне »
Сада ћемо још једном да пређемо кроз градиво да би добро овладали појмовима SNP и STR.

Узећемо три хипотетичка човека са именима: човек1, човек2 и човек3.



На илустрацији видимо делић њиховог ДНК кода. Замислићемо да посматрамо хипотетички сегмент DYS12345. Наранчастим квадратићима је приказано колико пута у кога се понавља STR секвенца CTA. Значи, човек1 има 5 понављања, човек2 6 и човек3, 7 понављања.  Тако би у њиховим резултатима тестирања било написано  DYS12345=5,6 и 7, респективно.

Како да знамо ко су од ових људи рођаци а ко не?

Постоје два начина за то...

На илустрацији видимо да  низ нуклеотида код све тројице почиње са GTAC  и после тога видимо да се човек1 разликује од остале двојице потоме што он има Т а они А (после чега је њихов низ опет једнак). То значи да човек1 има SNP мутацију коју друга двојица немају и то га искључује из позиције да буде блиски рођак ове друге двојице.  Тај SNP ће га сврстати у посебну хаплогрупу, док човек 2 и човек3 припадају истој хаплогрупи без обзира на то што имају различит број STR понављања!

Међутим, у пракси се ретко испитују SNP мутације из једног простог разлога- на сваком тесту би се морало урадити испитивање врло великог броја локација док се не утврди на којим местима постоји мутација а на којима не.  Много је практичније када се сваком човеку испитивају једне те исте вредности, односно, када пребројавамо STR понављања на стандардним локацијама. Доказано је да је могуће одредити хаплогрупу на основу неколико стандардних вредности за одређене DYS маркере.

Код неких хаплогрупа, то је врло једноставан посао. На пример, код хаплогрупе I2a2 која је карактеристична за део Германа из Немачке(Саксонија и северни делови) . Довољна су само четири маркера да би поуздано могли одредити припадност тој хаплогрупи. То су:

DYS392 = 11
DYS454 = 12
DYS455 = 10
YCAIIb =  19

У случају да само један број није једнак, ово правило више не важи.

Када би човек који има ове вредности после тога извршио ново тестирање (овај пут за STR),  добио би резултате да  је позитиван на следеће снипове:

L38/S154, L39/S155, L40/S156, L65/S159

То значи, људи који имају четири горње вредности STR понављања (11,12,10,19), ће имати и ове четири SNP мутације (L38/S154, L39/S155, L40/S156, L65/S159) које не постоје код других хаплогрупа.

Код многих хаплогрупа је доста теже утврдити припадност хаплогрупи и на много већем броју маркера. Понекад је за 100-постотну прецизност потребно испитати 17 маркера. Међутим, ту нам у помоћ долазе рачунарски програми који ће на основу унетих података лако одредити нашу хаплогрупу. Програми овога типа се називају предиктори.

« Последња измена: јануар 10, 2013, 08:25:05 поподне Kor »

Ван мреже Kor

  • Члан Друштва
  • Истраживач
  • *****
  • Поруке: 814
  • реверзни инжињеринг историје
Одг: Објашњење главних појмова везаних за генетичку генеалогију
« Одговор #11 послато: јануар 10, 2013, 08:50:37 поподне »
Рекли смо да се помоћу SNP мутација дефинишу хаплогрупе.



Узмимо на пример код нас три најчешће хаплогрупе I, R1a и E1b. Све три хаплогрупе имају све заједничке SNP мутације закључно са SNP SRY10831.1. Од тога места њихови претци полазе различитим путевима и данашњи носиоци хаплогрупе E1b имају снипове M145 и M35 који не постоје у остатку стабла. Претци R1a и I је настављају даље и стичу  мутацију М89 коју имају како носиоци R1a, тако и носиоци хаплогрупе I. Међутим, путеви им се ускоро разилазе и неки предак из хаплогрупе I добија мутацију M170 која их одваја од свих осталих хаплогрупа. То значи да једино код носилаца хаплогрупе I срећемо мутацију M170 и нигде више!

За то време, неки прапредак хаплогрупе R1a је добио мутацију M9 која је својствена како носиоцима те хаплогрупе, тако и многим другима, као што су N1c, Q, T.  После тога се појављује опет мутација M173 својствена за хаплогрупу R1 и на крају SRY10831.2 коју имају искључиво носиоци хаплогупе R1a.

Иако би по већем броју мутација изгледало да је R1a знатно старија од I, у ствари је ситуација управо супротна.

Стабло приказано у нашем примеру је прилично једноставно. У ствари, постоји велики број јединствених мутација од којих неке хаплогрупе имају и по десет мутација које не постоје код осталих.

ПРИМЕДБА: зелени текст на илустрацији "SNP којe немају обе хаплогрупе"  се односи на носиоце хаплогрупа Р1а и И.
« Последња измена: новембар 07, 2013, 06:37:39 поподне Kor »

Ван мреже Kor

  • Члан Друштва
  • Истраживач
  • *****
  • Поруке: 814
  • реверзни инжињеринг историје
Одг: Објашњење главних појмова везаних за генетичку генеалогију
« Одговор #12 послато: јануар 13, 2013, 03:55:31 поподне »
Званично стабло свих хаплогрупа са њиховим називима и снип мутацијама које дефинишу хаплогупре се налази на локацији: http://www.isogg.org/tree/index.html

Реч је о организацији ISOGG (International Society of Genetic Genealogy) која,  стандардизује називе хаплогрупа и на тај начин спречава да дође до забуне у њиховом тумачењу. Велики проблем ове младе науке је тај да су се неколико пута до сада морало драстично мењати називи појединих хаплогрупа, што изазва велике проблеме при тумачењу резултата из старијих извора.

На пример, хаплогрупа са којом се код нас врло често оперише (зато што је и најбројнија међу Србима) I2a-Din се по ISOGG номенклатури кроз прошлост називала овако:
-I1b
-I2a2
-I2a1b1а
-I2a1b3a (актуелни назив)

Да ствар буде још гора, хаплогрупа са старим називом I2b сада носи назив I2a2, што се дакле поклапа са старим називом за I2a-Din. У таквим случајевима, уколико поред назива немамо указану и снип мутацију, може да дође до великих грешака..

Да би се избегао овај проблем који долази са променама назива, доста често се користи номенклатура која има дескриптивни карактер. При раду са хаплогрупом I а захваљујући човеку који се зове Кен Нордтведт, врло често се хаплогрупе означавају само са називом који на неки начин детерминише ту хаплогрупу. Тако имамо називе као што су Dinaric, DIsles, Alpine, Western или Fleming, Tibor, Rosset... које означавају презимана у оквиру  којих је лоцирана та хаплогрупа.

Све називе за ове хаплогрупе, као и остале резултате до којих долази Нордтведт можете наћи овде: http://knordtvedt.home.bresnan.net/

Да погледамо мало како ISOGG дефинише стабла. За  пример ћемо узети (за сада) једну од најпростијих хаплогрупа која је карактеристична за Пакистан, Индију и друге земље централне Азије- хаплогрупу L.




Хаплогрупа започиње са "чистим словом" (у нашем случају L), док са десне стране видимо све познате мутације које носи припадници ове хаплогрупе и којих нема у осталим хаплогрупама.
Иза њега следи "колено" означено са L*.  Видимо да је оно пусто а намена му је да се ту привремено сместе све потенцијално откривене хаплогрупе које не спадају у гране L1 и L2, све до тренутка када се схвати на који начин с њима формирати нову грану стабла. Ту најчешће долазе поједини врло ретки и архаични примерци.
Иста ствар се касније понавља и са L1*, па затим са L1b* итд.... На  илустрацији смо их означили као "недефинисани".

Видимо да сваком називу хаплогрупе следује ознака снипа, например: M27, P329, L656, M349...


Као што видимо, снипови добијају називе који су комбинација словног и нумеричког дела. Словни део се добија од ознаке назива научне институције која је открила ту мутацију. Тако су ови са М откривени на Стенфорду- Калифорнија,
Са P на универзитету Аризоне, L  је откривен у лабораторији пројекта FTDNA итд итд....

Понекад имамо и два назива за исту мутацију као што је случај за M61/Page43 из нашег примера. То значи да је мутација откривена независним истраживањем на два места и готово истовремено. Ознака Page43 је исто што и PS43 и односи се на универзитет Вајтхед из Масачусетса.
« Последња измена: новембар 07, 2013, 06:39:13 поподне Kor »

Ван мреже Kor

  • Члан Друштва
  • Истраживач
  • *****
  • Поруке: 814
  • реверзни инжињеринг историје
Одг: Објашњење главних појмова везаних за генетичку генеалогију
« Одговор #13 послато: јануар 13, 2013, 04:40:14 поподне »
Веровали или не, ово је све што је потребно да знате са теоријске стране како би успешно могли да пратите разговор везан за генетичку генеалогију. Наравно, постоје и ствари које су много-много компликованије и које се углавном односе на прорачунавања везана са мутацијама. Међутим, ми ћемо тај део оставити стручњацима.

Ван мреже Kor

  • Члан Друштва
  • Истраживач
  • *****
  • Поруке: 814
  • реверзни инжињеринг историје
Одг: Објашњење главних појмова везаних за генетичку генеалогију
« Одговор #14 послато: јануар 23, 2013, 02:35:55 поподне »
Нашао сам на интернету један доста давно рађен сајт посвећен овој проблематици па сам одлучио да га уз мање дораде пренесем на форум. Оригинал се налази на адреси: http://www.freewebs.com/genetska_istrazivanja/


Шта су генетска истраживања?

Увод

Прво ћемо се позабавити основима генетике да бисмо разумели генетска истражиања.

Свака јединка хомо сапиенса или модерног (разумног) човека се састоји од милијарди ћелија које представљају основну јединицу човековог организма па и сваког вишећелијског организма.



Ћелија

Свака ћелија се састоји из ћелијске мембране која окружује ћелију и даје јој облик, цитоплазме која испуњава ћелијску мембрану иу којој се налазе ћелијске органеле (органи једне ћелије) као што су: Голџијев апарат, митохондрије, једро, ендоплазматични ретикулум, робосоми, лизосоми, пероксизоми и митохондрије.

Ради бољег схватања садржине овог сајта који ће се углавном бавити генетиком и делом историјом важно је да се упознамо са функцијама и градјом саме ћелије и њених органела. На овај начин ћемо лакше да разумемо процесе који се тичу генетских истраживања.

Голџијев апарат је ћелијска органела која се састоји од спљоштених дискоидних цистерни. Обично се налази у близини једра и сматра се да има улогу у управљању кретања молекула у ћелији.

Лозосоми су мембранозне кесице које садрже велики број хидролитичних ензима и служе за варење у ћелији.

Пероксизоми су органеле задужене за битне процесе оксидације масних киселина и аминокиселина (основне јединице протеина).

Митохондрије су врло сложене грађе и састоје се од спољашње и унутрашње мембране, а основна улога им је стварање енергије синтезом АТП (аденозин три фосфата). Укратко оне су задужене за синтезу (стварање) кисеоника (О2).

Ендоплазматични ретикулум се протеже од једра до површине ћелије. Ако садржи рибосоме онда се назива храпави, а ако не садржи назива се глатки ендоплазматични ретикулум. Њиегова улога је стварање липида (масти), сложених шећера и најбитнија улога стварање протеина.

Једро представља центар сваке еукариотске ћелије његов садрзај се назива нуклеоплазма. Његова основна улога је производња (синтеза) РНК и ДНК. У тој нуклеполазми се налазе хромосоми односно хромосомске ДНК. У једру се започиње деоба ћелије и у већини случајева налази се у центру ћелије.

Треба напоменути да се ћелије у зависности да ли садрже једро или не односно да ли су сложеније грађе или не деле на еукариотске (оне имају једро) и прокариотске (оне немају једро). Постоје такодје и разлике у сложености, с тим да су еукариотске ћелије сложене стурктуре, а прокатиотске ћелије простије али се сматра да су претече еукариотских ћелија.

Ван мреже Kor

  • Члан Друштва
  • Истраживач
  • *****
  • Поруке: 814
  • реверзни инжињеринг историје
Одг: Објашњење главних појмова везаних за генетичку генеалогију
« Одговор #15 послато: јануар 23, 2013, 02:38:03 поподне »
ДНК

ДНК представља скраћеницу од деоксирибонуклеинска киселина, она је одговорна за преношење генетског материјала. Постоје две врсте ДНК једна се налази у једру и преноси генетски материјал са оца на потомство, а друга ДНК се налази у митохондријама и преноси се искључиво преко мајке јер је сперматозоиди не садрже. Поред наследног материјала ДНК постоји још и РНК. РНК је скраћеница за рибонуклеинске киселине, а разликује се од ДНК по томе што садржи шећер рибозу, а ДНК деоксирибозу (према томе ради се о истом шећеру само што код ДНК тај шећер рибоза НЕМА атом кисеоника у положају 2 структурног распореда атома). ДНК се као и РНК састоји од 4 основне пуринске пиримидинске базе, такође што се тиче пуринских и пиримидинских база оне су исте и код ДНК и РНК с тим што код РНК имамо уместо Т-тимина, У-урацил. Разлика је такође присутна у структури. РНКланац је једнострук и није испреплетен као ДНК ланац.





                      ДНК ланац                                      РНК ланац

Састав

ДНК се састоји од пуринско-пиримидинских органских (органских зато што садрже угљеник) база које носе имена:

А-аденин

Ц-цитозин

Г-гуанин

Т-тимин

Да бисмо боље објаснили стурктуру ДНК морамо поменути фосфате за које се везују шећери градећи ланац на којем се налазе ове пуринске пиримидинске базе.

РНК састав:

А-аденин

Ц-цитозин

Г-гуанин

У-урацил (уместо Тимина)



Пиримидинске базе:



Пуринске базе:




Ове пуринско-пиримидинске базе се у генетици обележавају својим великим почетним словима код ДНК са А, Т, Г, Ц и код РНК са А, Ц, Г, У (уместо Т).
« Последња измена: јануар 23, 2013, 02:52:29 поподне Kor »

Ван мреже Kor

  • Члан Друштва
  • Истраживач
  • *****
  • Поруке: 814
  • реверзни инжињеринг историје
Одг: Објашњење главних појмова везаних за генетичку генеалогију
« Одговор #16 послато: јануар 23, 2013, 02:42:43 поподне »
Хромосоми

Грађа хромозома је врло сложена па је овде нећемо детаљно обрађивати, аи не верујем да би већина вас уопште и разумела.
Хромосоми се састоје од спирално испреплетаних ланаца ДНК, делови хромосома који носе наследне особине се називају ГЕНИ, а место на хромосому где се налазе гени се назива локус! Хромосоми се налазе у једру, састоје од кракова који се називају теломере, суженог дела где се ти кракови спајају, који се назива центромера.



Да би смо сликовито објаснили хромосоме замислите ДНК као библиотеку пуну књига е сад замислите да се у тој библиотеци налази пуно полица за држање тих кнњига, те полице можемо упоредити са хромосомима, а саме појединачне књиге са генима.

Постоје два типа хромосома X и Y. Оба су добила име по словима на која личе што се из приложеног може видети.





          Хромосоми

Људи садрже 23 пара ових хромосома значи 46 укупно. Од којих задњи пар одређује ПОЛ плода. Дакле ако плод има задњи пар хромозома ХХ у питању ће бити женска особа са свим секундарним карактеристикама женског пола. С друге стране ако плод има XY као задњи пар хромозома у питању ће бити мушки пол са свим својим особинама које знамо, да их не наводим (објаснићемо у поднаслову "спермогенеза" како долази до оплодње сперматозоидом који садржи X или Y хромозом). Скуп хромосома у једној ћелији се назива кариотип, а скуп хромосома у целом организму кариограм. Хромосоми могу бити хаплоидни тј појединачни и диплодини тј у пару. Код свих сложенијих организама и човека у соматским (телесним) ћелијама су присутни диплоидни (у пару) хромосоми, а код репродуктивних ћелија (сперматозоиди и јајне ћелије) присутни су хаплоидни хромосоми.

Х хромозом је много већи од свог Y пара и сматра се да при преклапању ова два хромосома измењују своје секвенце (мешају се) у проценту од 10-15% процената. Али сами Yхромосоми никад не могу да се мешају са Y хромосомом друге особе јер немогу да се у исто време нађу у организму тако да они остају чврсти и без утицаја више милиона година, али то се односи на само језгро односно 85-90% " мушких гена на Y хромосому "такодје научници сматрају да скоро цео (85-90%) Y хромозом нема репетиције односно понављања која су одлика Х хромосома. Док је код женских особа тј Х хромосома тај случај другачији јер свака жена у принципу може да има Х хромосоме од две различите биолошке мајке, и тада наступа њихово интензивно мешање. Са мушким Y хромосомима то није случај јер се никада као што смо већ напоменули не може наћи Y хромосоми од два различита претка у истој ћелији просто из разлога да будем баналан што мускарци не могу да рађају децу!

Дакле рекапитулирајмо оно до сада научено.Основна градја људког бића је ћелија она се састоји из органела, цитоплазме где се органеле налазе, мембране и једра у једру се налазе хромосоми који се састоје из испреплетаних ланца ДНК.   Сама ДНК се састоји из шећера деоксирибозе фосфорних једињења и база од којих је изграђена, а оне одређују какве ће од нас ко имати особине.

Овде долазимо до суштине, да би извршили генетску анализу морамо овај ланац ДНК поделити тј разбити на више делова. То се чини ензимима који имају такву специфичну улогу. Они разбијају ланац ДНК на чак до 1.000.000 парчића које се називају секвенце ДНК. Испитивањем секвенци дакле делова ДНК и то посебно одредјених можемо утврдити тип понављања различитих кодона. А кодони представљају парове ових база од којих је изграђена ДНК например ЦГТАГГТААЦТ је кодон код којег можемо приметити да се у овој специфичној секвенци ДНК налази цитозин, гуанин, тимин и аденин у одређеном распореду који је фиксан и такав распоред код различитих раса на пример може одредити боју коже коју имате и слично. Овај теоријски пример кодона је део само једног ланца ДНК док би се на другом ланцу нашле оне базе које се специфично везују за горе поменуте и то цитозин за гуанин и Аденин за Тимин:



На овој слици имамо ланац ДНК у првом ланцу видимо распоред база и то
редоследом АТААЦАГГЦГА то је први ланац, а испод њега имамо други
ланац за који је везан и то по формули цитозин за гуанин и Аденин за Тимин.
« Последња измена: јануар 23, 2013, 02:46:49 поподне Kor »

Ван мреже Kor

  • Члан Друштва
  • Истраживач
  • *****
  • Поруке: 814
  • реверзни инжињеринг историје
Одг: Објашњење главних појмова везаних за генетичку генеалогију
« Одговор #17 послато: јануар 23, 2013, 02:45:06 поподне »
Улога ДНК

Главна улога ДНК се своди на пренос генетског материјала, заправо све у нашем телу се своди на ДНК да није ње ни ми не би постојали. ДНК у својим секвенцама крије формуле за производњу протеина, за своје умножавање и производњу РНК. И основна улога је производња саме себе у процесу који се назива репликација. То је главна улога сваког живог бића од ћелије до човека. ДНК започиње своју деобу или умножавање када ствара себе саму наново, тај процес почиње раскидањем молекулских веза између њених база које смо навели (тимин, аденин, цитозин, гуанин) тада се у специјалним биомолекулским процесима који су јако компликовани ланци ДНК наново везују са новим нуклеинским киселинама и стварају своје нове копије. Пошто се нуклеинске киселине спајају само по одређеном распореду односни аденин само ца тимин и цитозин само са гуанин то је условљено њиховим сличним молекулским структурама. Приликом настајања новог ДНК ланца он задржава исти молекулски распоред као и мајка ДНК односно ДНК од које су настали:





На овај начин је извршена подела ДНК и стварају се НОВИ хромосоми од новонасталих ланаца ДНК. Деоба ћелије и њено умножавање почиње рецимо приликом зарастања рана, производње крвних зрнаца, раст и милиона других процеса у нашем организму. Гледано у бројкама свака појединачна ћелија садржи као што рекосмо 46 хромосома, 2 милиона ДНК ланаца, 3 милиона база (А, Г, Ц, Т) и 80.000 кодова за протеине који обављају све животне функције.
« Последња измена: јануар 23, 2013, 04:03:05 поподне admin »

Ван мреже Kor

  • Члан Друштва
  • Истраживач
  • *****
  • Поруке: 814
  • реверзни инжињеринг историје
Одг: Објашњење главних појмова везаних за генетичку генеалогију
« Одговор #18 послато: јануар 23, 2013, 04:47:23 поподне »
Спермогенеза

Стварање сперматозоида као наследног потенцијала се врши у тестисима и то одвајањем хромосома на X и Y засебно, за сваки сперматозоид. Што буквално значи да у сперматозоиду имате или X или Y хромозом па зависно од тога који сперматозоид први стигне до јајне ћелије плод ће бити мушко или женско биће! Следећи процеси које ћемо описати су у ствари суштина претходног писања у овом уводу. Приликом оплођења јајне ћелије на пример сперматозоидом који садржи  Y  хромосом добијамо плод који ћемо моћи касније да идентификујемо генетским истраживањима управо тим јединственим хромосомом односно његовим делом или ГЕН-ом. Ово је омогућило да се данас може са скоро 100% сигурношћу утврдити да ли је одређена особа отац детета или не јер је генетски  код за сваког човека понаособ јединствен као отисак прста и још прецизнији!

Новонастали плод у себи има нови пар хромозома један од оца и један од мајке. Претпоставимо да плод који ми описујемо има од оца Y хромозом тај плод ће бити мушког пола и од мајке ће наследити преко јајне ћелије и њене митохондријске ДНК, X хромозом! Сада генетским истраживањима можемо утврдити и директног женског родитеља поменутог плода преко ове митохондријске ДНК или скраћено мтДНК, која се наслеђује САМО и искљуциво преко јајне ћелије мајке јер га сперматозоид не садржи тако се ова мтДНК може се прености са генерације на генерацију! Треба рећи да мајчине гене на Х хромосому могу преносити и њихови мушки потомци јер га садрже (али не садрже мтДНК), па је тако чест случај да ћерке више личе на оца (јер је он на њих пренео гене своје мајке), а синови више личе на своје мајке јер садрже већину њихових гена што смо већ објаснили у процентима раније у уводу.

Сада плод настао спајањем јајне ћелије и сперматозоида и њиховим "уједињењем" има 23 нова пара хромозома која су створена у јајној ћелији процесом који може да траје 16-20 сати од уласка сперматозоида у јајну ћелију тада се ови хаплоидни полни хромосоми умножавају стварајући диплоидну ћелију која се зове зигот и од које настаје ембрион. Од ових нових (односно само умножених старих) хромосома 22 представљају ХХ пар хромозома и код женског и код мушког пола, док се на основу задњег пара одређује пол детета или плода. Код мушкараца овај задњи пар је XY, а код  жена XX.




Мушки



Женски

Дакле овде нам је јасно предочена слика мушког и женског кариотипа
с једином разликом што се код мушког задњи пар састоји од XY,
а женски од ХХ хромосома.Напомена: Ове две предходне слике су
праве слике хромосома, узетих и снимљених од мушке и женске особе,
сликане помоћу микроскопа.


Надам се да смо на основу досадашњих објашњења успели једном делу Вас који ово читате да објаснимо како настају ДНК, хромосоми и нови живот. Сада требамо објаснити зашто је за нас битно ово о чему смо до сада расправљали.

Па пошто смо вец рекли колико је значајан Y и ХХ хромозом за генетска истраживања, рецимо и једну просту чињеницу пошто се од 23 пара хромозома, 22 пара плус један директно наслеђује од мајке можете и сами предпоставити да је улога очевих гена у самом изгледу и физичким особинама плода веома мали, а код женског пола тај утицај и не постоји то јест изражено у процентима очеви гени у телу и мушког детета се своде на око 2.2%, а остало су мајчине особине док код женског он нема уопште своје "мушке гене" изражене преко Y хромозома!

Многи од вас ће се питати па какву то улогу уопште имају мушкарци јер већ смо рекли да је Y хромозом скоро комплетно "неактиван" (мада по најновијим истраживањима која су објављена то није тако али се до сада сматрало да јесте) што ће рећи нема неких задатака који се тичу синтезе протеина који су одговорни за грађу мишица итд Међутим према последњим истразивањима Y хромозома пронађено је да он има и те како велику улогу која се тиче пре свега мушког пола. Неки људи знају и да злоупотребе недовољну развијеност генетике као специфичне науке медју њима је свакако Брајан Сајкс (професор хумане генетике на оксфордском Институту за молекуларну медицину) који сматра да је Y хромозом "грешка" еволуције и да ће за 200.000 година нестати и да ће земљом ходати само жене. Што је благо речено ступидитет ако узмемо у обзир да огроман број не само сисара већ и свих других вишећелијских организама има мушки и женски пар. Међутим не лези враже, професор Сајкс је открио свој идентитет једног обичног авантуристе тврдећи да је на трагу чувеном Јетију митском бићу за кога се сматра да живи у поларним крајевима, то своје откриће заснива на проналаску само једне власи која по његовим истраживањима не одговара нијиедној другој врсти на земљи!?! Ето као што видите ни Оксфорд више није место где се образује интелектуална елита већ колико се мени чини само место за сензационалистичке авантуристе који свуда трче са својим бомбастичним изјавама, а после их се стиде. Жалосно али исинито .........

Наставимо започету прицу о функцији Y хромозома.  Дакле по новијим истраживањима објављеним у различитим научним часописима сматра се да Y хромозом није одговоран само са секундарне мушке карактеристике (полни органи и слично) већ да 78 гена у хромосому има улогу у стварању посебних протеинских структура у ћелијским зивдоима! Зашто је ово битно? Из једноставног разлога јер се ти гени налазе на местима за која се раније смртрало да су неактивни! Видите ја сам горе на пар места написао да се сматра да су Y хромосому углавном неактивни, и ту констатацију ћете наћи у већини књига која се баве генетиком. Медјутим морате усвојити и ова најновија открића и сазнања која се баве генима и која кажу да мушкарци заправо имају своје специфичне протеине мада се још незна које још све особине код мушког пола зависе од ових гена јер је испитан практично врло мали део Y хромозома и његових гена, а истразивачи се труде да започето наставе тако да ће се наредних година сигурно знати колико особина проистиче из овог хромосома! Наука зато и постоји да би се унапређивала и мењала!

Пошто нас овде посебно занима Y хромозом треба рећи да он има своје тврдо језгро које се не мења и не меша са много већим X хромосомом па с тога треба знати да су гени одговорни за мушки пол углавном генетски чисти и да их је немогуће измешати са " женским јер 90% таквог гена има свој сталан и непромењен састав! Ви се сигурно питате како онда одржава своју стабилност и функцију јер нема с ким да измени своје ДНК ланце потребне за стварање и синтезу хромосома? Одговор је једноставан он то чини са X хромосомом у оних 10% свог потенцијала гена, а што се осталог дела тиче он то чини преплетањем СОПСТВЕНИХ теломера или крака хромозома па на овај начин он сам себе поправља и одржава функционалност!

Код X хромосома је ситуација много другачија јер се они мешају и преузимају читаве сегменте једни од других, ово доприноси мешању генетског материјала код жена   и између раса али само у погледу тих "женских" гена, међутим пошто таквих у организму сваког човека има око 97%, изглед првенствено зависи од њих!




                       Овде је описан процес сегментације хромосома и размена гена међу
X хромосомима (мешање). Дакле овде имамо претечу сперматозоида и јајне
ћелије (1.), даље, хромосоми се дупликују (2.) и размена сегмената почиње (3.)
процес размене сегмената се назива рекомбинација хромосома, после
овог процеса (4.) се раздвајају у засебне ћелије; код мушкараца у сперматозоиде,
а код жена у јајне ћелије (5.) (треба напоменути да само једна од четри новонастале
јајне ћелије може бити оплодјена). 

Сматра да је улога самог мушког пола у тој такозваној еволутивој лествици, јер преплитање и мешање хромосома у оквиру једне расе доводи до бољег функционисања гена и њихово унапређење, а то је једино могуће са мушкарцима који преносе генетски материјал не само свој Y хромозом већ и «женски» Х хромозом. Мишљење је доле потписаних аутора да напредак и еволуцију у генима може довести само интензивно мешање у оквиру једне расе, а не мешањем измедју раса што би буквално довело не до напредка вец стагнације и назадовања.

Ово се наводи из простог разлога јер је велики број обољења у модерном свету условљен мешањем између раса што су открили британски научници. Објашњење овакве појаве је једноставно јер једна раса се пуно разликује од друге па кад дође до мешања у погледу тих "женских" Х хромосома остају "рупе" у тим протеинским зидовима ћелија што на глобалном плану читавог организма доводи до његове слабости услед некомпатибилности тих протеина. На тај начин само тело је ослабљено не само у имуном погледу већ и у погледу физичке конституције и таква особа никада неће моћи да постигне врхунске резултате, а о интелектуланој инфериорности истих не треба трошити речи!

Треба напоменути да су ова објашњења намењена људима који нису имали додира са медицинским струкама и да је генерално врло упрошћен да би био њима прихватљивији!
Ажурирано: Децембар 6, 2004

Објављено: Децембар 7,2004
« Последња измена: јануар 24, 2013, 12:20:56 пре подне admin »

Ван мреже Kor

  • Члан Друштва
  • Истраживач
  • *****
  • Поруке: 814
  • реверзни инжињеринг историје
Одг: Објашњење главних појмова везаних за генетичку генеалогију
« Одговор #19 послато: јануар 23, 2013, 04:49:39 поподне »
Пренео сам текст у целости мада је завршетак текста врло дискутабилан и потенцијално расистички. Наиме, нека најновија истраживања су показала да код врхунских афро-америчких споритста постоји значајно учешће генетике белих људи.